|
Back to 2014 Annual Meeting Abstracts
Sequence alterations in the WEE1 non-coding region is a facilitator and marker for pancreatic tumorigenesis
Fernando Blanco, Janáe A. Ritz-Romeo, Theresa P. Yeo, Charles J. Yeo, Jonathan R. Brody, Jordan M. Winter*
Surgery, Thomas Jefferson University, Philadelphia, Pennsylvania, United States
Introduction: We discovered an abnormal sequence motif in a 56 bp non-coding region of the mitotic kinase inhibitor WEE1 in pancreatic adenocarcinoma, which contains the binding site of an RNA binding protein, HuR (important for cancer cell survival). WEE1 promotes DNA repair by regulating a mitotic checkpoint in the setting of DNA damage. We hypothesize that a germline sequence alteration (INDEL, insertion/deletion of bases) in WEE1 impairs HuR stabilization of the WEE1 transcript and abrogates this critical checkpoint in cells to enhance proliferation. Paradoxically, this phenotype could render cells susceptible to DNA damaging agents.
Experimental Methods: The 56 bp HuR binding site on the WEE1 transcript was sequenced in 21 cancer cell lines, 30 familial pancreatic cancers, and 68 patients with normal pancreata. Functional assays were performed in cell lines with wild type and abnormal WEE1 sequence after treatment with mitomycin C (MMC).
Results: An INDEL was identified in the poly-T track of the 56 bp region (ATGTACCTGTGTGTCCATCTTATATTTCTTTTTTTTTTAATTGTGAATTAGAC), which has 10 T’s in the wild type sequence. In the control group, 51 patients had two wild type alleles, and 17 were heterozygous for a TT insertion (12 T’s), establishing an abnormal allelic frequency of 12.5%. In 21 cancer cell lines, 10 were homozygous for the wild type sequence, and 11 exhibited a TT insertion. In 5 of these cell lines, the second allele exhibited a separate abnormality (11 T’s). In total, the abnormal allelic frequency was three-fold increased at 38%. In 30 familial pancreatic cancers, 12 were homozygous for the wild type sequence and 18 had the TT insertion (abnormal allelic frequency of 30%, p<0.0003 vs. controls). MMC (i.e., DNA damage) treatment of pancreatic cancer cell lines results in HuR movement from the nucleus to the cytoplasm with its bound mRNA (e.g., the WEE1 transcript). MMC induced WEE1 protein expression by Western blot in cell lines with wild type sequence, but not in cell lines containing INDELs in both alleles. Reporter constructs with luciferase in front of the HuR-WEE1 binding site (both wild type and abnormal sequence) were generated. Upon treatment with MMC, reporter activity was reduced with plasmids containing the TT insertion. Interestingly, biallelic abnormal binding site sequences (while observed in 5/21 cancer cell lines) were never identified in the germline of any patients (n=98, expected in 5% of individuals), suggesting that this sequence motif is functionally important and embryonic lethal.
Conclusions: The incidence of a TT insertion in the HuR binding site on WEE1 is increased in familial pancreatic cancer and results in decreased WEE1 expression upon DNA damage. These findings may have important implications for 1) genetic screening, 2) predicting chemo-responsiveness, 3) and the development of novel therapies
Back to 2014 Annual Meeting Abstracts
|
